Topics |
Gene Name | trinucleotide repeat containing 6a | Gene Symbol | Tnrc6a | ||||
---|---|---|---|---|---|---|---|
Chromosome | 7 | Genomic Location | chr7:130,265,000-130,340,000 | ||||
Synonyms | 2010321I05Rik, 3110054G10Rik, CAGH26, D130023A07Rik, MGC:11932, Tnrc6, GW182, AW557223 | ||||||
Links | UCSC Browser(chr7:130,265,000-130,340,000) NCBI Entrez Gene(233833) IGTC(Tnrc6a, 13951) UniGene(Mm.102305) |
MGI(2385292) KEGG GENES(mmu:233833) EST Profile(Mm.102305) |
Other clone trapped this gene |
---|
Trap vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
---|---|---|---|---|---|
Accession | AB325685 | GSS Location | chr7:130,267,712-130,268,229 | Size | 183 |
Sequence | CGGCGGCAGCGGGACGGTGTAGAAAATGGCGCTGGTGCAGCGGCTCGGGCCTGTCCCCGCGGCGC TGCGGAGGGCTTGAGGCTCGCGAGCCTCGTTCCCCGCGCCTCACGCGCTAGTGCACTTTACACAC ATGAGAGAATTGGAAGCTAAAGCTACCAAAGACGTAGAGAGAAATCTTAGCAG |
||||
Links | UCSC Browser(chr7:130,267,712-130,268,229) IGTC(Ayu21-T247) |
[AK147327] Mus musculus cDNA, RIKEN full-length enriched library, clone:M5C1013H20 product:trinucleotide repeat containing 6, full insert sequence. |
Card ID | 1185 | Strain Name | B6;CB-Tnrc6aGt(pU-21T)247Imeg |
---|---|---|---|
Internal Code | Ayu21-T247 | ||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
Links |
IMSR (for Tnrc6a) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |