Topics

<Return to clone list

ID  21-T250
Registered  2007.07.06    Last Update  2018.06.03
Gene Name increased sodium tolerance 1 homolog (yeast) Gene Symbol Ist1
Chromosome 8 Genomic Location chr8:112,194,700-112,218,000
Synonyms 2400003C14Rik, mKIAA0174, AW536298
Links UCSC Browser(chr8:112,194,700-112,218,000)
NCBI Entrez Gene(71955)
IGTC(Ist1, 5796)
UniGene(Mm.290036)
MGI(1919205)
KEGG GENES(mmu:71955)
EST Profile(Mm.290036)
Other clone trapped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB331659 GSS Location chr8:112,217,084-112,217,183 Size 100
Sequence CTTGAGTCCGCGGTGGGGAGGTCGAGGGAGTCGCCATTTTGGATGCCGAGCGGCTCCTCGGAAGT
CGGCTTCTTCCGTTTTCACGTCCGGATCCCTCCAG
Links UCSC Browser(chr8:112,217,084-112,217,183)
IGTC(Ayu21-T250)

Homology Search Results

[AK134464] Mus musculus 11 days embryo head cDNA, RIKEN full-length enriched library, clone:6230401G18 product:unclassifiable, full insert sequence.

Mouse Information

Card ID 1295 Strain Name B6;CB-Ist1Gt(pU-21T)250Imeg
Internal Code Ayu21-T250
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Ist1)

<Return to clone list