Topics

<Return to clone list

ID  21-T252
Registered  2007.07.06    Last Update  2009.02.11
Gene Name RIKEN cDNA 9430038I01 gene Gene Symbol 9430038I01Rik
Chromosome 7 Genomic Location chr7:144,565,000-144,606,000
Synonyms
Links UCSC Browser(chr7:144,565,000-144,606,000)
NCBI Entrez Gene(77252)
IGTC(9430038I01Rik, 23423)
UniGene(Mm.29184)
MGI(1924502)
KEGG GENES(mmu:77252)
EST Profile(Mm.29184)
Other clone trapped this gene
21-W888
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB331660 GSS Location chr7:144,602,323-144,602,406 Size 84
Sequence GGTACGTGAAGCCGCATGGACAGCCTGGCGTCGGGCCGCTGGAGACGGCGGAGGACGGAGGAGCT
GCCAGCGGCGGGGGACGCG
Links UCSC Browser(chr7:144,602,323-144,602,406)
IGTC(Ayu21-T252)

Homology Search Results

[AK078159] Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330584I18 product:RIKEN cDNA 9430038I01 gene, full insert sequence.

Mouse Information

Card ID 1068 Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for 9430038I01Rik)

<Return to clone list