Topics

<Return to clone list

ID  21-T27
Registered  2006.07.04    Last Update  2015.08.17
Gene Name RIKEN cDNA 2700038G22 gene Gene Symbol 2700038G22Rik
Chromosome 5 Genomic Location chr5:23,356,400-23,361,000
Synonyms
Links UCSC Browser(chr5:23,356,400-23,361,000)
NCBI Entrez Gene(67194)
IGTC
UniGene
MGI(1914444)
KEGG GENES
EST Profile
Other clone trapped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB264608 GSS Location chr5:23,356,417-23,359,773 Size 290
Sequence TCTTCCGCCGCGGCGCGCTCCTGATGAGTGCTGTGTCCAGGATGATCATGAATTCAAGCTCTGGA
GCTTGAGATGAACTGGTCCGAGTTCTAGAAGAGAAGGTTCCCCCCCCCCCCCCAGGAAAAGCCAG
TGCAGTTACCTGACAGTGAGTAAACCCGATGTTTCTTGTGGTTTCGTCAGATCTACCATCGCCTG
CCAGCCTGACCTGCTTTGACCCCGCAGACTGTCCCTGTCCCCTCTGAACAAAAGGATGGCTGTTG
CACAGCAGCCTTATGGTTTGGTTGCTGCAG
Links UCSC Browser(chr5:23,356,417-23,359,773)
IGTC(Ayu21-T27)

Homology Search Results

[AK002390] Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610009F16 product:unclassifiable, full insert sequence.

Mouse Information

Card ID 829 Strain Name B6-2700038G22RikGt(pU-21T)27Imeg
Internal Code Ayu21-T27
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for 2700038G22Rik)

<Return to clone list