Topics

<Return to clone list

ID  21-T327
Registered  2007.08.10    Last Update  2018.06.11
Gene Name filamin binding LIM protein 1 Gene Symbol Fblim1
Chromosome 4 Genomic Location chr4:141,131,000-141,163,000
Synonyms 2410043F08Rik, Fblp1, migfilin, migfilin(s), Cal, Gt10
Links UCSC Browser(chr4:141,131,000-141,163,000)
NCBI Entrez Gene(74202)
IGTC(Fblim1, 1577)
UniGene(Mm.286536)
MGI(1921452)
KEGG GENES(mmu:74202)
EST Profile(Mm.286536)
Other clone trapped this gene
21-KBW66, 21-B6T19
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB354920 GSS Location chr4:141,151,810-141,155,799 Size 91
Sequence CAGCGCCGGCGGAGGCCGGGCGTGGGGAGCGCGGCAGTGGAGCTGGCCTGAACTTTGGACCTTGT
CTTCCAGTAGGAAATCAGTCTCTCAG
Links UCSC Browser(chr4:141,151,810-141,155,799)
IGTC(Ayu21-T327)

Homology Search Results

[X66903] M.musculus En-2/lacZ junction mRNA (Gt10).

Mouse Information

Card ID 1108 Strain Name B6;CB-Fblim1Gt(pU-21T)327Imeg
Internal Code Ayu21-T327
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Fblim1)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list