Topics

<Return to clone list

ID  21-T340
Registered  2007.06.28    Last Update  2018.06.11
Gene Name TELO2 interacting protein 1 Gene Symbol Tti1
Chromosome 2 Genomic Location chr2:157,805,000-157,870,000
Synonyms 2610036D13Rik, AI449463
Links UCSC Browser(chr2:157,805,000-157,870,000)
NCBI Entrez Gene(75425)
IGTC(Tti1, 4615)
UniGene(Mm.29068)
MGI(1922675)
KEGG GENES(mmu:75425)
EST Profile(Mm.29068)
Other clone trapped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB330747 GSS Location chr2:157,854,110-157,854,148 Size 39
Sequence GCAGGAGGCGGGAGAGTGAGGGAAAGACTGGAAGACGAG
Links UCSC Browser(chr2:157,854,110-157,854,148)
IGTC(Ayu21-T340)

Homology Search Results

[AK128940] Mus musculus cDNA fis, clone TRACH3005702.

Mouse Information

Card ID 1806 Strain Name B6;CB-Tti1Gt(pU-21T)340Card
Internal Code Ayu21-T340
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Tti1)

<Return to clone list