Topics

<Return to clone list

ID  21-T346
Registered  2007.06.28    Last Update  2018.06.11
Gene Name homeobox containing 1 Gene Symbol Hmbox1
Chromosome 14 Genomic Location chr14:65,430,000-65,570,000
Synonyms F830020C16Rik , Hot1, AI451877, AI604847
Links UCSC Browser(chr14:65,430,000-65,570,000)
NCBI Entrez Gene(219150)
IGTC(Hmbox1, 23517)
UniGene(Mm.344074)
MGI(2445066)
KEGG GENES(mmu:219150)
EST Profile(Mm.344074)
Other clone trapped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB330749 GSS Location chr14:65,568,414-65,568,494 Size 81
Sequence TCCTCCCTCCCTCAGCCTTGCACTGGGACGCTGGGGAGGGGGCTGAGCAGGGTGCAGAGAACTCT
CAGCTGGATTTCCAAG
Links UCSC Browser(chr14:65,568,414-65,568,494)
IGTC(Ayu21-T346)

Homology Search Results

[BC051457] Mus musculus homeobox containing 1, mRNA (cDNA clone MGC:56991 IMAGE:6398463), complete cds.
[AK161592] Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330438L16 product:similar to Hypothetical homeobox domain containing protein [Mus musculus], full insert sequence.

Mouse Information

Card ID 1591 Strain Name B6;CB-Hmbox1Gt(pU-21T)346Card
Internal Code Ayu21-T346
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "HOT1 is a mammalian direct telomere repeat-binding protein contributing to telomerase recruitment." Kappei, D., Butter, F., Benda, C., Scheibe, M., Drakovic, I., Stevense, M., Novo, C. L., Basquin, C., Araki, M., Araki, K., Krastev, D. B., Kittler, R., Jessberger, R., Londono-Vallejo, J. A., Mann, M., Buchholz, F., EMBO J., 32 (12), 1681-1701 (2013). PubMed ID:23685356.
Links IMSR (for Hmbox1)

<Return to clone list