Topics

<Return to clone list

ID  21-T347
Registered  2007.06.28    Last Update  2018.06.11
Gene Name RNA binding protein gene with multiple splicing Gene Symbol Rbpms
Chromosome 8 Genomic Location chr8:34,890,000-35,050,000
Synonyms 2010300K22Rik, 2700019M19Rik, hermes, RBP-MS, hermes, AU017537
Links UCSC Browser(chr8:34,890,000-35,050,000)
NCBI Entrez Gene(19663)
IGTC(Rbpms, 201)
UniGene(Mm.323997)
MGI(1334446)
KEGG GENES(mmu:19663)
EST Profile(Mm.323997)
Other clone trapped this gene
21-T73, K16E08
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB330750 GSS Location chr8:34,973,458-35,039,999 Size 232
Sequence CAAAGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGAGGAGGAGGTCCGGACCCTAT
TTGTCAGCGGTCTGCCTCTGGACATCAAGCCCCGAGAGCTGTACCTGCTCTTCAGACCATTCAAG
GGCTATGAAGGTTCTCTCATAAAGCTCACATCTAAACAGCCCGTAGGCTTTGTCAGTTTTGACAG
TCGCTCAGAAGCAGAGGCCGCAAAGAACGCTTTGAAC
Links UCSC Browser(chr8:34,973,458-35,039,999)
IGTC(Ayu21-T347)

Homology Search Results

[BC030397] Mus musculus RNA binding protein gene with multiple splicing, mRNA (cDNA clone MGC:40656 IMAGE:4225078), complete cds.

Mouse Information

Card ID 1072 Strain Name B6;CB-RbpmsGt(pU-21T)347Card
Internal Code Ayu21-T347
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Rbpms)

<Return to clone list