Topics

<Return to clone list

ID  21-T36
Registered  2006.07.20    Last Update  2015.08.17
Gene Name RIKEN cDNA 2410006H16 gene Gene Symbol 2410006H16Rik
Chromosome 11 Genomic Location chr11:62,416,300-62,418,350
Synonyms
Links UCSC Browser(chr11:62,416,300-62,418,350)
NCBI Entrez Gene(69221)
IGTC(2410006H16Rik, 23357)
UniGene(Mm.270874)
MGI(1916471)
KEGG GENES
EST Profile(Mm.270874)
Other clone trapped this gene
21-B6T17, 21-T20, 21-T210, 21-W125, 21-W263
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB265218 GSS Location chr11:62,416,379-62,416,525 Size 147
Sequence CTCTGCGGCCATCATGGGATCGTGCTCTTCTCGCTCGTTGAGCTGGTCCCTTCGCCGTGGCCTGC
TGGTGACGGTCTGGAGCGATGCTGAGCCCGGGCCCAGCCTCTCAGCTCCGCCTTGTGCGCTGCAC
AGATCTAGGGGAGCCTG
Links UCSC Browser(chr11:62,416,379-62,416,525)
IGTC(Ayu21-T36)

Homology Search Results

[AK010427] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410006H16 product:unclassifiable, full insert sequence.

Mouse Information

Card ID 867 Strain Name B6-2410006H16RikGt(pU-21T)36Imeg
Internal Code Ayu21-T36
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for 2410006H16Rik)

<Return to clone list