Topics

<Return to clone list

ID  21-T492
Registered  2008.01.14    Last Update  2018.11.12
Gene Name New Gene Symbol New
Chromosome 16 Genomic Location chr16:3,110,942-3,130,241
Synonyms
Links UCSC Browser(chr16:3,110,942-3,130,241)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB375401 GSS Location chr16:3,120,496-3,120,688 Size 199
Sequence AAAGTCTCATGTTGAGAGACGCTATCATGCATGTCACGAGTTAGTATTTTGGGAGAGGTGTTCAG
CAGCCTCTGGTTCTATCTGTACCTTCAAAATCTACACAAGGCTGGACTAACCTGAAGGAGTAAAC
AGGAATCTCAGGGAGCACACAGTGGCCATGGAATACTTCCACCAAAGATATATTCGGAAGGTCTA
TAAG
Links UCSC Browser(chr16:3,120,496-3,120,688)
IGTC(Ayu21-T492)

Homology Search Results

[CC326788] RRI199 BayGenomics Gene Trap Library pGT0Lxf Mus musculus cDNA, mRNA sequence.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for New)

<Return to clone list