Topics

<Return to clone list

ID  21-T525
Registered  2008.01.15    Last Update  2018.06.13
Gene Name transportin 1 Gene Symbol Tnpo1
Chromosome 13 Genomic Location chr13:99,610,000-99,697,000
Synonyms MIP; TRN; IPO2; MIP1; Kpnb2; AU021749; D13Ertd688e
Links UCSC Browser(chr13:99,610,000-99,697,000)
NCBI Entrez Gene(238799)
IGTC(Tnpo1, 2258)
UniGene(Mm.173286)
MGI(2681523)
KEGG GENES(mmu:238799)
EST Profile(Mm.173286)
Other clone trapped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB375790 GSS Location chr13:99,696,206-99,696,298 Size 94
Sequence GTTCCGCAGCCATTTCAGGCCCCGGACGGGAGGCAGCGCCGCTTCGGCAGAAAGGCCCGAGCGCC
GGAGGACTTCTGGGATGGTGTGGGACCGG
Links UCSC Browser(chr13:99,696,206-99,696,298)
IGTC(Ayu21-T525)

Homology Search Results

[AK030580] Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330434M13 product:IMPORTIN BETA-2 SUBUNIT (KARYOPHERIN BETA-2 SUBUNIT) (TRANSPORTIN) (M9 REGION INTERACTION PROTEIN) (MIP) homolog [Homo sapiens], full insert sequence.

Mouse Information

Card ID 2313 Strain Name B6.Cg-Tnpo1Gt(pU-21T)525Card
Internal Code Ayu21-T525
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Tnpo1)

<Return to clone list