Topics

<Return to clone list

ID  21-T57
Registered  2006.10.14    Last Update  2018.06.13
Gene Name F-box protein 17 Gene Symbol Fbxo17
Chromosome 7 Genomic Location chr7:29,501,500-29,524,000
Synonyms Fbg4, Fbx17, Fbxo26
Links UCSC Browser(chr7:29,501,500-29,524,000)
NCBI Entrez Gene(50760)
IGTC(Fbxo17, 23364)
UniGene(Mm.358659)
MGI(1354707)
KEGG GENES(mmu:50760)
EST Profile(Mm.358659)
Other clone traped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB278133 GSS Location chr7:29,501,801-29,502,057 Size 257
Sequence TGTCCACCAGGGGATTGGCAGCCACGTTTCAGGGACAGGCGGCCTAGCTCGGCGGCCCTGGGCCG
GGCTCACTCAGGCTGCAACGTTGCCCGGTGGCCCCGGGATCCTGAGCATAGAAGAAGACGGTCCA
CTAGGACCCCAGATCACGGGGCTGACTTCCCGGACCTCGGGTTACTCTTCGACTGCCTCCAGCGC
CGGGTAGGGATTGGATCTTCCCCGCCAACTCAGAGCAGGCCGCCCGGTGAGCTCCCGGACAG
Links UCSC Browser(chr7:29,501,801-29,502,057)
IGTC(Ayu21-T57)

Homology Search Results

[BC026470] Mus musculus F-box protein 17, mRNA (cDNA clone MGC:31493 IMAGE:4486850), complete cds.

Mouse Information

Card ID 839 Strain Name B6;CB-Fbxo17Gt(pU-21T)57Imeg
Internal Code Ayu21-T57
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
Links IMSR (for Fbxo17)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list