Topics

<Return to clone list

ID  21-T62
Registered  2006.10.30    Last Update  2008.01.18
Gene Name GDNF-inducible zinc finger protein 1 Gene Symbol Gzf1
Chromosome 2 Genomic Location chr2:148,506,600-148,519,000
Synonyms Zfp336
Links UCSC Browser(chr2:148,506,600-148,519,000)
NCBI Entrez Gene(74533)
IGTC(Gzf1, 15611)
UniGene(Mm.136913)
MGI(1921783)
KEGG GENES(mmu:74533)
EST Profile(Mm.136913)
Other clone traped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB279759 GSS Location chr2:148,506,759-148,506,950 Size 192
Sequence GTAAGATCACGTAACCAACGGCCGGAACCGCCTTTGCAGCTGGAGGTGCGCGCGCAGCGCCTTCC
TAGCCTACGGGGGGCGGAGCCCACTAGGGGGCGGGGCGCGCTCGTGGCGACCAATCCGCGGACCC
TGCGGTCCGCTGTCCCTGCTGGCCTGGGCCAGGGTACGGGTCCGTGGAGGCACTGGCTAAGA
Links UCSC Browser(chr2:148,506,759-148,506,950)
IGTC(Ayu21-T62)

Homology Search Results

[BY722861] BY722861 RIKEN full-length enriched, adult male bone Mus musculus cDNA clone 9830170B10 5', mRNA sequence.

Mouse Information

Card ID 1033 Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Gzf1)

<Return to clone list