Topics

<Return to clone list

ID  21-T62
Registered  2006.10.30    Last Update  2018.06.13
Gene Name GDNF-inducible zinc finger protein 1 Gene Symbol Gzf1
Chromosome 2 Genomic Location chr2:148,506,600-148,519,000
Synonyms 8430437G08Rik, Zfp336, mGZF1
Links UCSC Browser(chr2:148,506,600-148,519,000)
NCBI Entrez Gene(74533)
IGTC(Gzf1, 15611)
UniGene(Mm.136913)
MGI(1921783)
KEGG GENES(mmu:74533)
EST Profile(Mm.136913)
Other clone traped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB279759 GSS Location chr2:148,506,759-148,506,950 Size 192
Sequence GTAAGATCACGTAACCAACGGCCGGAACCGCCTTTGCAGCTGGAGGTGCGCGCGCAGCGCCTTCC
TAGCCTACGGGGGGCGGAGCCCACTAGGGGGCGGGGCGCGCTCGTGGCGACCAATCCGCGGACCC
TGCGGTCCGCTGTCCCTGCTGGCCTGGGCCAGGGTACGGGTCCGTGGAGGCACTGGCTAAGA
Links UCSC Browser(chr2:148,506,759-148,506,950)
IGTC

Homology Search Results

[BY722861] BY722861 RIKEN full-length enriched, adult male bone Mus musculus cDNA clone 9830170B10 5', mRNA sequence.

Mouse Information

Card ID 1033 Strain Name B6;CB-Gzf1Gt(pU-21T)62Card
Internal Code Ayu21-T62
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Gzf1)

<Return to clone list