| Topics |
ID 21-T63
| Gene Name | predicted gene 5141 | Gene Symbol | Gm5141 | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 13 | Genomic Location | chr13:62,873,500-62,887,500 | ||||
| Synonyms | |||||||
| Links | UCSC Browser(chr13:62,873,500-62,887,500) NCBI Entrez Gene(380850) IGTC(Gm5141, 50596) UniGene(Mm.439823) |
MGI(3779466) KEGG GENES(mmu:380850) EST Profile(Mm.439823) |
|||||
| Other clone trapped this gene |
|---|
| Trap vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB278134 | GSS Location | chr13:62,887,043-62,887,150 | Size | 109 |
| Sequence | CTCTCTGTTCCTCTCCGTTGCGAGCAGGCTGAAAGATTGATCTGATTTGTTTTCATCTCTGCTGA CAGGGGCCTTAGGGAATTGCCAGCGATCTACAACCTGGCGAAAG |
||||
| Links | UCSC Browser(chr13:62,887,043-62,887,150) IGTC(Ayu21-T63) |
||||
Homology Search Results
| [BC064714] Mus musculus similar to hypothetical protein FLJ14345, mRNA (cDNA clone IMAGE:30251863). |
Mouse Information
| Card ID | 2883 | Strain Name | B6;CB-Gm5141Gt(pU-21T)63Card |
|---|---|---|---|
| Internal Code | Ayu21-T63 | ||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
| Links |
IMSR (for Gm5141) |
||