Topics

<Return to clone list

ID  21-T63
Registered  2006.10.14    Last Update  2020.06.02
Gene Name predicted gene 5141 Gene Symbol Gm5141
Chromosome 13 Genomic Location chr13:62,873,500-62,887,500
Synonyms
Links UCSC Browser(chr13:62,873,500-62,887,500)
NCBI Entrez Gene(380850)
IGTC(Gm5141, 50596)
UniGene(Mm.439823)
MGI(3779466)
KEGG GENES(mmu:380850)
EST Profile(Mm.439823)
Other clone traped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB278134 GSS Location chr13:62,887,043-62,887,150 Size 109
Sequence CTCTCTGTTCCTCTCCGTTGCGAGCAGGCTGAAAGATTGATCTGATTTGTTTTCATCTCTGCTGA
CAGGGGCCTTAGGGAATTGCCAGCGATCTACAACCTGGCGAAAG
Links UCSC Browser(chr13:62,887,043-62,887,150)
IGTC(Ayu21-T63)

Homology Search Results

[BC064714] Mus musculus similar to hypothetical protein FLJ14345, mRNA (cDNA clone IMAGE:30251863).

Mouse Information

Card ID 2883 Strain Name B6;CB-Gm5141Gt(pU-21T)63Card
Internal Code Ayu21-T63
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Gm5141)

<Return to clone list