Topics

<Return to clone list

ID  21-T97
Registered  2006.10.30    Last Update  2021.04.28
Gene Name zinc finger protein 986 Gene Symbol Zfp986
Chromosome 4 Genomic Location chr4:146,591,589-146,714,021
Synonyms Gm13154
Links UCSC Browser(chr4:146,591,589-146,714,021)
NCBI Entrez Gene(433804)
IGTC(Zfp986, 12769)
UniGene(Mm.332047)
MGI(3651986)
KEGG GENES(mmu:433804)
EST Profile(Mm.332047)
Other clone trapped this gene
21-KBW202
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB279761 GSS Location chr4:146,604,382-146,606,552 Size 256
Sequence ATTCCAGCATTCTCAATGTATCTCGGCTGCCTCGTGGTCAGGAAGTCTTGGAGGGAGACTAGTGC
CTAGTGTTTGCGGAACCTGAAAACTTCCTTAAGCTGCAGTTGCTGTGCTGGCCTCCTAGGATATT
CAGCAGCTGGTCCTGTCACCTGCCAGATCAGAGGTCTCCATATGCTCATTCAAATCTCCATAACT
GTAAATCAACACTAAGAGCACTGGATAGTTAAGGTCAAGGAGACTCTCACAAAGGATCCAG
Links UCSC Browser(chr4:146,604,382-146,606,552)
IGTC(Ayu21-T97)

Homology Search Results

[AK049536] Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430020H24 product:hypothetical KRAB box containing protein, full insert sequence.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Zfp986)

<Return to clone list