| Topics |
ID 21-T97
| Gene Name | zinc finger protein 985 | Gene Symbol | Zfp985 | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 4 | Genomic Location | chr4:146,591,589-146,714,021 | ||||
| Synonyms | Gm13154 | ||||||
| Links | UCSC Browser(chr4:146,591,589-146,714,021) NCBI Entrez Gene(433804) IGTC(Zfp985, 12769) UniGene(Mm.332047) |
MGI(3651986) KEGG GENES(mmu:433804) EST Profile(Mm.332047) |
|||||
| Other clone trapped this gene |
|---|
| 21-W240 |
| Trap vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB279761 | GSS Location | chr4:146,604,382-146,606,552 | Size | 256 |
| Sequence | ATTCCAGCATTCTCAATGTATCTCGGCTGCCTCGTGGTCAGGAAGTCTTGGAGGGAGACTAGTGC CTAGTGTTTGCGGAACCTGAAAACTTCCTTAAGCTGCAGTTGCTGTGCTGGCCTCCTAGGATATT CAGCAGCTGGTCCTGTCACCTGCCAGATCAGAGGTCTCCATATGCTCATTCAAATCTCCATAACT GTAAATCAACACTAAGAGCACTGGATAGTTAAGGTCAAGGAGACTCTCACAAAGGATCCAG |
||||
| Links | UCSC Browser(chr4:146,604,382-146,606,552) IGTC(Ayu21-T97) |
||||
Homology Search Results
| [AK049536] Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430020H24 product:hypothetical KRAB box containing protein, full insert sequence. |
Mouse Information
| Card ID | Strain Name | ||
|---|---|---|---|
| Internal Code | |||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||
| Links |
IMSR (for Zfp985) |
||