Topics

<Return to clone list

ID  21-W11
Registered  2008.03.14    Last Update  2018.06.14
Gene Name RIKEN cDNA 5830417I10 gene Gene Symbol 5830417I10Rik
Chromosome 3 Genomic Location chr3:88,578,000-88,720,000
Synonyms 3632445O20Rik, AA387005
Links UCSC Browser(chr3:88,578,000-88,720,000)
NCBI Entrez Gene(100302730)
IGTC(5830417I10Rik, 17115)
UniGene(Mm.126870)
MGI(1923272)
KEGG GENES(mmu:76022)
EST Profile(Mm.126870)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB427137 GSS Location chr3:88,581,027-88,581,436 Size 410
Sequence GAAGCCAGACACGGACCAGCTCCCAGACAGCGCGTCAGAGTCCCTGTCCTGGGGTCAGAGTCAGG
ACAGTGCAGTGTGCCCTGAAGGGCTCTCCATGCAGGATGGAGACGATCAGCTCAGGGCAGAGGGG
CTGTCTTTGAACTCGAAGATGCTGGCCCAGCATGTGAACTTAGCAGTCTTGGAAGCCGTTGATGT
AGCTGTCTCTCAGGAAATCCCCCTTCCCTCCTTGGAGTCTTCTCATTCCCTTCCTGTACATGTGG
ATAAAGGGAGACTCCAGGTCTCTGCCTCAAAGAAAGGGAAGAGAGTTGTCTTTACACCTGGGCAG
GTTACCAGAGAAGACCGAGGGGATCACCCTGTCCCAGAGGAGCCTCCTTCAGGAGAGCCTGCTGA
AGAAGCCAAGACGGAAGGAG
Links UCSC Browser(chr3:88,581,027-88,581,436)
IGTC(Ayu21-W11)

Homology Search Results

[AK005385] Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500041I23 product:hypothetical protein, full insert sequence.

Mouse Information

Card ID 1178 Strain Name B6;CB-5830417I10RikGt(pU-21W)11Card
Internal Code Ayu21-W11
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for 5830417I10Rik)

<Return to clone list