Topics

<Return to clone list

ID  21-W114
Registered  2008.10.26    Last Update  2019.03.23
Gene Name New Gene Symbol New
Chromosome 7 Genomic Location chr7:26,050,187-26,054,956
Synonyms
Links UCSC Browser(chr7:26,050,187-26,054,956)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB467275 GSS Location chr7:26,052,546-26,052,598 Size 49
Sequence GTTGGTGCTGGTAAACCCAGAGTAGAGAAGTTTGGGGTAGGAAGAGGAG
Links UCSC Browser(chr7:26,052,546-26,052,598)
IGTC(Ayu21-W114)

Homology Search Results

Mouse Information

Card ID 2770 Strain Name B6;CB-Gt(pU-21W)114Card
Internal Code Ayu21-W114
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for New)

<Return to clone list