Topics

<Return to clone list

ID  21-W122
Registered  2008.09.21    Last Update  2018.06.14
Gene Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 Gene Symbol Psmd11
Chromosome 11 Genomic Location chr11:80,241,000-80,287,000
Synonyms 1700089D09Rik, 1810019E17Rik, 2610024G20Rik, 2810055C24Rik, C78232, P44.5, S9
Links UCSC Browser(chr11:80,241,000-80,287,000)
NCBI Entrez Gene(69077)
IGTC(Psmd11, 2216)
UniGene(Mm.260539)
MGI(1916327)
KEGG GENES(mmu:69077)
EST Profile(Mm.260539)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB458556 GSS Location chr11:80,242,123-80,242,257 Size 135
Sequence CCGGCGTCGGCGGCCGCGGCCGGGGACGGTGTGAGAGCGGTAAGATGGCGGCCGCAGCGGTGGTG
GAGTTCCAGAGAGCCCAGTCTCTACTCAGCACCGACCGGGAGGCCTCCATCGACATCCTCCACTC
CATCG
Links UCSC Browser(chr11:80,242,123-80,242,257)
IGTC(Ayu21-W122)

Homology Search Results

[AK166950] Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0025C22 product:proteasome (prosome, macropain) 26S subunit, non-ATPase, 11, full insert sequence.

Mouse Information

Card ID 1778 Strain Name B6;CB-Psmd11Gt(pU-21W)122Card
Internal Code Ayu21-W122
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Psmd11)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list