| Topics |
ID 21-W126
| Gene Name | ELOVL family member 6, elongation of long chain fatty acids (yeast) | Gene Symbol | Elovl6 | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 3 | Genomic Location | chr3:129,233,000-129,345,000 | ||||
| Synonyms | FEN1/Elo2, SUR4/Elo3-like, LCE, FAE, LCE, C77826 | ||||||
| Links | UCSC Browser(chr3:129,233,000-129,345,000) NCBI Entrez Gene(170439) IGTC(Elovl6, 3436) UniGene(Mm.314113) |
MGI(2156528) KEGG GENES(mmu:170439) EST Profile(Mm.314113) |
|||||
| Other clone trapped this gene |
|---|
| 21-W272, 21-W564, 21-W584 |
| Trap vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB458558 | GSS Location | chr3:129,235,564-129,308,090 | Size | 256 |
| Sequence | CAGAGAACACGTAGCGACTCCGAAGATCAGCCCCAATGAACATGTCAGTGTTGACTTTACAAGAA TATGAATTCGAAAAGCAGTTCAACGAGAACGAAGCCATCCAATGGATGCAGGAAAACTGGAAGAA GTCTTTCCTGTTTTCTGCGCTGTACGCTGCCTTTATCTTTGGTGGTCGGCATCTGATGAACAAGC GAGCCAAGTTTGAACTTCGGAAGCCGCTCGTGCTCTGGTCGCTGACTCTTGCCGTCTTCAG |
||||
| Links | UCSC Browser(chr3:129,235,564-129,308,090) IGTC |
||||
Homology Search Results
| [BC100576] Mus musculus ELOVL family member 6, elongation of long chain fatty acids (yeast), mRNA (cDNA clone MGC:118673 IMAGE:30097278), complete cds. |
Mouse Information
| Card ID | 1225 | Strain Name | B6;CB-Elovl6Gt(pU-21W)126Card |
|---|---|---|---|
| Internal Code | Ayu21-W126 | ||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
| Links |
IMSR (for Elovl6) |
||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |