Topics

<Return to clone list

ID  21-W126
Registered  2008.09.21    Last Update  2018.06.14
Gene Name ELOVL family member 6, elongation of long chain fatty acids (yeast) Gene Symbol Elovl6
Chromosome 3 Genomic Location chr3:129,233,000-129,345,000
Synonyms FEN1/Elo2, SUR4/Elo3-like, LCE, FAE, LCE, C77826
Links UCSC Browser(chr3:129,233,000-129,345,000)
NCBI Entrez Gene(170439)
IGTC(Elovl6, 3436)
UniGene(Mm.314113)
MGI(2156528)
KEGG GENES(mmu:170439)
EST Profile(Mm.314113)
Other clone traped this gene
21-W272, 21-W564, 21-W584
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB458558 GSS Location chr3:129,235,564-129,308,090 Size 256
Sequence CAGAGAACACGTAGCGACTCCGAAGATCAGCCCCAATGAACATGTCAGTGTTGACTTTACAAGAA
TATGAATTCGAAAAGCAGTTCAACGAGAACGAAGCCATCCAATGGATGCAGGAAAACTGGAAGAA
GTCTTTCCTGTTTTCTGCGCTGTACGCTGCCTTTATCTTTGGTGGTCGGCATCTGATGAACAAGC
GAGCCAAGTTTGAACTTCGGAAGCCGCTCGTGCTCTGGTCGCTGACTCTTGCCGTCTTCAG
Links UCSC Browser(chr3:129,235,564-129,308,090)
IGTC

Homology Search Results

[BC100576] Mus musculus ELOVL family member 6, elongation of long chain fatty acids (yeast), mRNA (cDNA clone MGC:118673 IMAGE:30097278), complete cds.

Mouse Information

Card ID 1225 Strain Name B6;CB-Elovl6Gt(pU-21W)126Card
Internal Code Ayu21-W126
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Elovl6)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list