Topics

<Return to clone list

ID  21-W142
Registered  2008.10.04    Last Update  2018.06.15
Gene Name RAB3A interacting protein Gene Symbol Rab3ip
Chromosome 10 Genomic Location chr10:116,340,000-116,390,000
Synonyms Gtpat12, Rabin3, SSX2 interacting protein, B230311A06
Links UCSC Browser(chr10:116,340,000-116,390,000)
NCBI Entrez Gene(216363)
IGTC(Rab3ip, 7353)
UniGene(Mm.336394)
MGI(105933)
KEGG GENES(mmu:216363)
EST Profile(Mm.336394)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB462427 GSS Location chr10:116,365,245-116,374,714 Size 358
Sequence TCAGCGCTCATGCTCCGGATCCAGCATCATCGGTACCCTCTGCGGTAGCATCAGGGCTCACGAAG
TTAACCTCCAGGAAGGACAGCTGTAATGCAGAGAGGGAGTTTCTGCAGGGCGCCACCATCACCGA
GGCTTCTGCTGGCAATGATGACATCTTTGGGTTGAGCACGGATAGCCTGTCGCGTTTACGAAGCC
CATCTGTTCTGGAAGTTAGAGAGAAGGGCTACGAAAGGTTAAAGGAAGAACTTGCAAAAGCTCAG
AGGGAATTGAAGTTAAAAATGAAGAATGTGAGAGACTTTCGAAAGTGCGGGATCAACTTGGGCAG
GAGTTGGAAGAACTCACAGCTAGTTTGTTTGAG
Links UCSC Browser(chr10:116,365,245-116,374,714)
IGTC(Ayu21-W142)

Homology Search Results

[AK152122] Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830048F14 product:RAB3A interacting protein, full insert sequence.

Mouse Information

Card ID 1221 Strain Name B6;CB-Rab3ipGt(pU-21W)142Card
Internal Code Ayu21-W142
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Rab3ip)

<Return to clone list