Topics

<Return to clone list

ID  21-W145
Registered  2008.10.29    Last Update  2018.06.15
Gene Name fibroblast growth factor receptor 1 Gene Symbol Fgfr1
Chromosome 8 Genomic Location chr8:26,628,000-26,688,000
Synonyms Eask, Fgfr-1, FGFR-I, Flt-2, Hspy, FLG, MFR, c-fgr, AW208770, bFGF-R-1
Links UCSC Browser(chr8:26,628,000-26,688,000)
NCBI Entrez Gene(14182)
IGTC(Fgfr1, 1091)
UniGene(Mm.265716)
MGI(95522)
KEGG GENES(mmu:14182)
EST Profile(Mm.265716)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB468964 GSS Location chr8:26,629,632-26,629,901 Size 270
Sequence GGGGGGCGCACGATCTGGGGACCCCGGGCGGCGGACCCGAGCCCTCCCCCCCGCCCCGCCTCCGG
GGCACCAGCTTCGGCTCCATTGTTCCCGCCCGGGCTGGAGGCGCCCGGCTCGGAGTGCCGCCGGG
AGTCGTGCCTCGGCCGCGGAGCCCTCGAGACCCCATCAGGATCTGAACGGAGCCCGGAGACGAGC
GGCGGGAGCGCAAGACACAGACACCCGCCGCGCCACGGCGAGCTCTCCAGAGGCGGGACCGCAGC
GCCAAGTGAG
Links UCSC Browser(chr8:26,629,632-26,629,901)
IGTC(Ayu21-W145)

Homology Search Results

[BC010200] Mus musculus fibroblast growth factor receptor 1, mRNA (cDNA clone MGC:11564 IMAGE:3967874), complete cds.

Mouse Information

Card ID 1235 Strain Name B6;CB-Fgfr1Gt(pU-21W)145Card
Internal Code Ayu21-W145
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Fgfr1)

<Return to clone list