Topics

<Return to clone list

ID  21-W195
Registered  2009.04.01    Last Update  2018.06.17
Gene Name piezo-type mechanosensitive ion channel component 1 Gene Symbol Piezo1
Chromosome 8 Genomic Location chr8:125,003,987-125,076,094
Synonyms Fam38a, Piezo1, mKIAA0233, 9630020g22
Links UCSC Browser(chr8:125,003,987-125,076,094)
NCBI Entrez Gene(234839)
IGTC(Piezo1, 12878)
UniGene(Mm.37324)
MGI(3603204)
KEGG GENES(mmu:234839)
EST Profile(Mm.37324)
Other clone trapped this gene
21-W533
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB494460 GSS Location chr8:125,074,875-125,075,097 Size 223
Sequence GGCCGGCGACCCGAGATCGAGGCCGGCGGGAGGTCACAGCAGCCGCGCGCCGCACGTGCGGAGAC
CCGCCCAGAGTGCCATGGCGCGCGGTTCCTCCGGCCCTCGCACCTCCCTTTAGCCACGGCGGCGC
GACCCCGGGCGGTCCCCCGGCCGCGGGGCATGGAGCCGCACGTGCTGGGCGCCGGGCTCTACTGG
CTGTTGCTGCCCTGCACGCTCCTGGCGG
Links UCSC Browser(chr8:125,074,875-125,075,097)
IGTC(Ayu21-W195)

Homology Search Results

[CJ142731] CJ142731 RIKEN full-length enriched mouse cDNA library, C57BL/6J inner ear adult Mus musculus cDNA clone F930050L11 5', mRNA sequence.
[NM_001037298] Mus musculus family with sequence similarity 38, member A (Fam38a), mRNA.

Mouse Information

Card ID 2331 Strain Name B6.Cg-Fam38aGt(pU-21W)195Card
Internal Code Ayu21-W195
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Piezo1)

<Return to clone list