Topics

<Return to clone list

ID  21-W206
Registered  2009.04.06    Last Update  2020.06.02
Gene Name EST Gene Symbol EST
Chromosome 4 Genomic Location chr4:145,100,000-145,600,000
Synonyms
Links UCSC Browser(chr4:145,100,000-145,600,000)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB495078 GSS Location chr4:145,264,409-145,264,543 Size 135
Sequence AGCATTCTCCTTGTACCTTGGCTGCCTCATGGTCAGGAAGTCCTGGAGGAAGACTAGTGCCTAGT
ATTTGCAGAACCTGAAAACTTCCTTGCTGACCTCCTAGGACATTGAGCAGCTGGTCCTGTCACCT
TTCAG
Links UCSC Browser(chr4:145,264,409-145,264,543)
IGTC

Homology Search Results

[CZ444596] CG0344 Sanger Institute Gene Trap Library pGT0lxrT2 Mus musculus cDNA, mRNA sequence.

Mouse Information

Card ID 2867 Strain Name B6;CB-Gt(pU-21W)206Card
Internal Code Ayu21-W206
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for EST)

<Return to clone list