Topics

<Return to clone list

ID  21-W224
Registered  2009.05.22    Last Update  2018.08.29
Gene Name CREB3 regulatory factor Gene Symbol Crebrf
Chromosome 17 Genomic Location chr17:26,852,000-26,912,000
Synonyms A930001N09Rik, RP23-478C2.1
Links UCSC Browser(chr17:26,852,000-26,912,000)
NCBI Entrez Gene(77128)
IGTC(Crebrf, 9850)
UniGene(Mm.275414)
MGI(1924378)
KEGG GENES(mmu:77128)
EST Profile(Mm.275414)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB504285 GSS Location chr17:26,852,602-26,852,719 Size 118
Sequence GCGATTTCCGGGAACCCGTCAGGAAGGACATAAACAAAACAAACCGAGGCAGCATGGAGACGGCC
CGCGGCCGCGTAAGCGCGGCCGGATCCAGTGCCTGAACCGCCTTCAGCCTCAG
Links UCSC Browser(chr17:26,852,602-26,852,719)
IGTC(Ayu21-W224)

Homology Search Results

[AK030092] Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932441F15 product:hypothetical protein, full insert sequence.

Mouse Information

Card ID 1310 Strain Name B6;CB-A930001N09RikGt(pU-21W)224Card
Internal Code Ayu21-W224
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Crebrf)

<Return to clone list