Topics

<Return to clone list

ID  21-W23
Registered  2009.01.15    Last Update  2018.11.12
Gene Name New Gene Symbol New
Chromosome Unlocalized Genomic Location
Synonyms
Links UCSC Browser
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB477047 GSS Location Size 164
Sequence CGAGTTAGTATTTTGGGAGAGGTGTTCANGCAGCCTCTGGTTCTATCTGTACCTTCAAAATCTAC
ACAAGGCTGGACTAACCTGAAGGAGTAAACAGGAATCTCAGGGAGCACACAGTGGCCATGGAATA
CTTCCACCAAAGATATATTCGGAAGGTCTATAAG
Links UCSC Browser
IGTC(Ayu21-W23)

Homology Search Results

[CC326788] RRI199 BayGenomics Gene Trap Library pGT0Lxf Mus musculus cDNA, mRNA sequence.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for New)

<Return to clone list