Topics

<Return to clone list

ID  21-W264
Registered  2009.06.01    Last Update  2020.04.02
Gene Name 45S rRNA gene Gene Symbol 45SrRNA
Chromosome Unknown Genomic Location
Synonyms
Links UCSC Browser
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
21-W237, 21-27, 21-77, 21-111, 21-40, 21-B105, 21-B197, 21-T25, 21-B170, 21-B150, 21-T22, 21-T42, 21-T90, 21-T110, 21-T1, 21-B203, 21-KBW171, 21-T184, 21-B121, 21-T109, 21-T185, 21-T189, 21-T339, 21-T204, 21-T211, 21-B136, 21-T428, 21-T454, 21-T103, 21-T482, 21-W70, 21-W92, 21-T111, 21-MT90, 21-W100, 21-W130, 21-T284, 21-W137, 21-W212, 21-MT61, 21-KBW217, 21-W332, 21-T302, 21-MT31, 21-MT45, 21-W325, 21-W342, 21-W369, 21-W381, 21-W531, 21-W547, 21-W555, 21-MT38, 21-T205, 21-T267, 21-MT50, 21-MT40, 21-MT53, 21-MT79, 21-MT142, 21-MT110, 21-MT114, 21-B187, 21-B199
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB505802 GSS Location Size 270
Sequence CAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGGCCTCGGGGAGAGTTCTCTTTTCT
TTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGCCCGTGCCTTGGAAAGCG
TCGCGGTTCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCCTTGAAAATCCGGGGGAGAGGGTGTAA
ATCTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCTCCAAGGTGAACAGCCTCTGGCATGTTG
GAACAATGTA
Links UCSC Browser
IGTC(Ayu21-W264)

Homology Search Results

[X82564] M.musculus 45S pre rRNA gene.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for 45SrRNA)

<Return to clone list