Topics

<Return to clone list

ID  21-W276
Registered  2009.07.01    Last Update  2018.09.05
Gene Name potassium channel tetramerisation domain containing 10 Gene Symbol Kctd10
Chromosome 5 Genomic Location chr5:114,813,000-114,831,000
Synonyms C87062, AW536343, MGC11654, mBACURD3
Links UCSC Browser(chr5:114,813,000-114,831,000)
NCBI Entrez Gene(330171)
IGTC(Kctd10, 10039)
UniGene(Mm.238285)
MGI(2141207)
KEGG GENES(mmu:330171)
EST Profile(Mm.238285)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB510933 GSS Location chr5:114,830,435-114,830,512 Size 78
Sequence CCCCTGCATTGAGCGAGCTGGGTGTTTCCTGCCTCTCAGTCCGGATTTGGAGACTCCGGCGTCCT
CCGACTTTTCATG
Links UCSC Browser(chr5:114,830,435-114,830,512)
IGTC(Ayu21-W276)

Homology Search Results

[NM_001159941] Mus musculus potassium channel tetramerisation domain containing 10 (Kctd10), transcript variant 1, mRNA.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Kctd10)

<Return to clone list