Topics

<Return to clone list

ID  21-W280
Registered  2009.08.29    Last Update  2018.09.05
Gene Name LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene Symbol Lsm3
Chromosome 6 Genomic Location chr6:91,465,800-91,472,900
Synonyms USS2, SMX4, 1010001J12Rik, 2610005D18Rik, 6030401D18Rik, LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated
Links UCSC Browser(chr6:91,465,800-91,472,900)
NCBI Entrez Gene(67678)
IGTC(Lsm3, 13888)
UniGene(Mm.246693)
MGI(1914928)
KEGG GENES(mmu:67678)
EST Profile(Mm.246693)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB517699 GSS Location chr6:91,466,005-91,469,638 Size 274
Sequence TGAGTTCCTGTTCCCGCGAGAGGTGGAAAGGGCGCAGCGTTTGAAACATGGCGGACGACGTAGAT
CAGCAACAGACCACCAATACCGTAGAGGAGCCCCTGGATCTGATCAGGTCAGCCTGGATGAGCGA
ATTTATGTGAAAATGAGAAATGACCGAGAGCTTCGAGGCAGACTACACGCTTATGATCAACATTT
AAATATGATCCTGGGAGATGTAGAAGAAACTGTGACAACGATAGAGATTGATGAGGAGACATATG
AAGAGATATATAAA
Links UCSC Browser(chr6:91,466,005-91,469,638)
IGTC(Ayu21-W280)

Homology Search Results

[NM_026309] Mus musculus LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) (Lsm3), mRNA.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Lsm3)

<Return to clone list