Topics

<Return to clone list

ID  21-W289
Registered  2010.11.05    Last Update  2018.09.08
Gene Name gon-4-like (C.elegans) Gene Symbol Gon4l
Chromosome 3 Genomic Location chr3:88,636,965-88,715,061
Synonyms 1500041I23Rik, 2610100B20Rik, mKIAA1606
Links UCSC Browser(chr3:88,636,965-88,715,061)
NCBI Entrez Gene(76022)
IGTC(Gon4l, 12378)
UniGene(Mm.126870)
MGI(1917579)
KEGG GENES(mmu:76022)
EST Profile(Mm.126870)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB597983 GSS Location chr3:88,640,913-88,641,174 Size 375
Sequence GGTGCGTTACTTCCGGCTGGGCAGAGCTGAGTTTCCGCGGATCAGAAGCGGGCCTCTGAAGGAAT
GGAACAGACGTGGAACTTGTAAAATGTTGCCCTGTTAAGAAGAGAAAGACTTTTCAGTGACCGAG
TCTTCTTCAGCAGCAAGATGACCAGGAGGGTGATGACTTGGACCTAGAGGCAGCTGTGAAGCCAG
ACACGGACCAGTCCCAGACAGCGCGTCAGAGTCCCTGTCCTGGGGTCAGAGTCAGGACAGTGCAG
TGTGCCCTGAAGGGCTCTTCCATGCAGGATGGAGACGATCAGCTCAGGGCAGAGGGGCTGTCTTT
GAACAGATACTCTAGAACTCTAGAACTAGACTAGTGAAGAGGAACCGAAA
Links UCSC Browser(chr3:88,640,913-88,641,174)
IGTC(Ayu21-W289)

Homology Search Results

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Gon4l)

<Return to clone list