Topics

<Return to clone list

ID  21-W292
Registered  2009.12.02    Last Update  2018.09.05
Gene Name chromodomain helicase DNA binding protein 7 Gene Symbol Chd7
Chromosome 4 Genomic Location chr4:8,617,000-8,800,000
Synonyms Dz, Mt, Cyn, Edy, Flo, Lda, Obt, Whi, Cycn, Todo, WBE1, A730019I05Rik, RP23-464N23.1, GENA 47, Gena 52, GENA 60, metis
Links UCSC Browser(chr4:8,617,000-8,800,000)
NCBI Entrez Gene(320790)
IGTC(Chd7, 6803)
UniGene(Mm.138792)
MGI(2444748)
KEGG GENES(mmu:320790)
EST Profile(Mm.138792)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB535724 GSS Location chr4:8,617,624-8,617,922 Size 299
Sequence CGGCGGCAGCGGTGGCGGCGGCGGCGCGGGGGTTGAGCCGTGGTGGTGCGGACGCGCTCGTGCTC
GGGAACTATCGGATTAAACTTGAATCGAGTGGAATTACACAAAGGAGCGCCGCGGAGGAGGCGGC
CCGGGGACCCGGAGACCCCGCAACTCGCCAGAGCCCCGTCCGCGCGCGGCCAACTCCGCGTCCGT
GGATCAGCCCCCGGCCGCGGCCGCCGAGCCAACTCCGGAGCCGCTCTGCGTTTTGTTCCCCACGG
CGCGCGGCGGCTGACTAGCCCGAGCGAAGGAGCGAGCCG
Links UCSC Browser(chr4:8,617,624-8,617,922)
IGTC(Ayu21-W292)

Homology Search Results

[BY184860] BY184860 RIKEN full-length enriched, NOD-derived CD11c +ve dendritic cells Mus musculus cDNA clone F630117O09 5', mRNA sequence.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Chd7)

<Return to clone list