Topics

<Return to clone list

ID  21-W293
Registered  2009.06.16    Last Update  2018.09.05
Gene Name HECT domain containing 1 Gene Symbol Hectd1
Chromosome 12 Genomic Location chr12:52,843,520-52,932,526
Synonyms opm, AI844876, MGC12070, A630086P08Rik, b2b327Clo
Links UCSC Browser(chr12:52,843,520-52,932,526)
NCBI Entrez Gene(207304)
IGTC(Hectd1, 7304)
UniGene(Mm.249391)
MGI(2384768)
KEGG GENES(mmu:207304)
EST Profile(Mm.249391)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB508938 GSS Location chr12:52,928,339-52,930,535 Size 508
Sequence GGCCGACCCTTCTCCTGCCCCCGCCCGGCTGGCGATGGACGCGGCGTCTCCCCGCTGCCGCCGAC
GGCCCCGCGCGGACCTGGCTCTGAACCGCAGGGTCTGAGGAGCCGCGTGCTGGGGTCGGGACCCG
CGCTGGCTGCCGCCGCTCGGGGGAGCCTCTCGCTTCCTTGTCACCGGGTCCCCGCGGAGGAAGGG
GAGGGACGAGACACGGCTTTTCCTGTGCCGCCTGCCTGGCTCGACCTGCGCGGCCTGCGGTTTCC
TAGGAACTCGAGGGCCGCGGCCGGGCCAGGCTCTGCCCGCGGCCTGCTTGGAGCTGGACCGGAGC
TGTTTGGTACGGCGAGCCAGGGCAAAGGAGCATTTTAAAGACAATGGCAGATGTAGATCCTGATA
CGTTGCTGGAATGGCTGCAGATGGGACAGGGAGATGAAAGGGACATGCAGCTAATAGCCCTGGAG
CAGCTATGCATGCTGCTTTTGATGTCTGACAATGTGGATCGCTGTTTTGAAAC
Links UCSC Browser(chr12:52,928,339-52,930,535)
IGTC(Ayu21-W293)

Homology Search Results

[NM_144788] Mus musculus HECT domain containing 1 (Hectd1), mRNA.

Mouse Information

Card ID 1588 Strain Name B6;CB-Hectd1Gt(pU-21W)293Card
Internal Code Ayu21-W293
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Hectd1)

<Return to clone list