Topics

<Return to clone list

ID  21-W295
Registered  2009.06.16    Last Update  2018.09.05
Gene Name tRNA methyltransferase 10C Gene Symbol Trmt10c
Chromosome 16 Genomic Location chr16:56,033,700-56,038,000
Synonyms Rg9mtd1, Rnmtd1, MGC118020, D16Ertd454e, 1300018J16Rik
Links UCSC Browser(chr16:56,033,700-56,038,000)
NCBI Entrez Gene(52575)
IGTC(Trmt10c, 13831)
UniGene(Mm.288742)
MGI(1196261)
KEGG GENES(mmu:52575)
EST Profile(Mm.288742)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB508939 GSS Location chr16:56,037,614-56,037,889 Size 276
Sequence CGCTCGCGGTGCAGTGCAGGCCGCGGTGTGCACGCGGATCTGCTCCGGAGTCCTGCAGCCCAGCC
GCCGGCCGCAGTCTGGGTACCTGCGGAGCTTCTCTCTGCCGGTGCTGGGGTGCTGGGTGGACCCG
CTGGCTTTCCAGAATGCGGGGCGTGGAACGTGGCCTCTGAGAACCCCAGGCGAGAGGAAGCCGTG
CTGTAGGAGTCGTTAGGCACGGCGCTACCTGAAGCGGAAGCCGCGTTCACCCAGATCGTCTCCTG
TGTCGCGCTTTAAAGT
Links UCSC Browser(chr16:56,037,614-56,037,889)
IGTC(Ayu21-W295)

Homology Search Results

[NM_029092] Mus musculus RNA (guanine-9-) methyltransferase domain containing 1 (Rg9mtd1), mRNA.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Trmt10c)

<Return to clone list