Topics

<Return to clone list

ID  21-W30
Registered  2008.04.24    Last Update  2018.09.05
Gene Name EST Gene Symbol EST
Chromosome 2 Genomic Location chr2:174,805,492-177,819,285
Synonyms
Links UCSC Browser(chr2:174,805,492-177,819,285)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB435088 GSS Location chr2:176,615,737-176,615,845 Size 115
Sequence CCCCCGAGTTCCTCTCTTTAACTCAGGTGACCTGAGTGTTTCTATGTGTTGCTTTNTTAGGTGTC
TNCAGTGAGTGCTGGGAGGGTAAATCAGGCAAGATCAGAACTTCAGACAG
Links UCSC Browser(chr2:176,615,737-176,615,845)
IGTC(Ayu21-W30)

Homology Search Results

[AK164563] Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330045G02 product:unclassifiable, full insert sequence.

Mouse Information

Card ID 2256 Strain Name B6.Cg-UnknownGt(pU-21W)30Card
Internal Code Ayu21-W30
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for EST)

<Return to clone list