Topics

<Return to clone list

ID  21-W303
Registered  2009.06.16    Last Update  2018.09.05
Gene Name parvin, beta Gene Symbol Parvb
Chromosome 15 Genomic Location chr15:84,060,000-84,148,000
Synonyms D15Gsk1, AI595373; AW742462, affixin
Links UCSC Browser(chr15:84,060,000-84,148,000)
NCBI Entrez Gene(170736)
IGTC(Parvb, 3884)
UniGene(Mm.323892)
MGI(2153063)
KEGG GENES(mmu:170736)
EST Profile(Mm.323892)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB508943 GSS Location chr15:84,062,492-84,103,999 Size 286
Sequence GCACTCGCTTATGTCCTCCGCGCCACCACGGTCGCCCACCCCGCGGGCCCCCAAGATGAAGAAGG
ACGAGTCTTTCTTGGGCAAGTTGGGCGGCACACTGGCAAGGAAGAAGAAGACCAGGGAGGTGACT
GACTTACAGGAAGAAGGCAAGAGCGCCATCAACTCTCCAATGGCCCCGGCTTTGGTGGACATTCA
CCCTGAAGACACCCAGCTAGAGGAGAATGAGGAGCGTACCATGATCGATCCCACCTCTAGAGAAG
ACCCCAAGTTCAAGGAGTTGGTCAAG
Links UCSC Browser(chr15:84,062,492-84,103,999)
IGTC(Ayu21-W303)

Homology Search Results

[NM_133167] Mus musculus parvin, beta (Parvb), mRNA.

Mouse Information

Card ID 1620 Strain Name B6;CB-ParvbGt(pU-21W)303Card
Internal Code Ayu21-W303
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Parvb)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list