| Topics |
ID 21-W312
| Gene Name | histone PARylation factor 1 | Gene Symbol | Hpf1 | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 8 | Genomic Location | chr8:63,369,000-63,387,000 | ||||
| Synonyms | C230006B22Rik, 2700029M09Rik, C4orf27 | ||||||
| Links | UCSC Browser(chr8:63,369,000-63,387,000) NCBI Entrez Gene(72612) IGTC(Hpf1, 14134) UniGene(Mm.25263) |
MGI(1919862) KEGG GENES(mmu:72612) EST Profile(Mm.25263) |
|||||
| Other clone trapped this gene |
|---|
| Trap vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB514150 | GSS Location | chr8:63,369,247-63,369,333 | Size | 87 |
| Sequence | CAGGAGCGCGGGCCTTGGCTCGCTCGCTGCGGCTGCGGGATGGTTGGCGGTGGCGGGAAGCGCCG GACGGCCGGGGCGGGACCGCAG |
||||
| Links | UCSC Browser(chr8:63,369,247-63,369,333) IGTC(Ayu21-W312) |
||||
Homology Search Results
| [NM_028299] Mus musculus RIKEN cDNA 2700029M09 gene (2700029M09Rik), mRNA. |
Mouse Information
| Card ID | 1674 | Strain Name | B6;CB-2700029M09RikGt(pU-21W)312Card |
|---|---|---|---|
| Internal Code | Ayu21-W312 | ||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
| Links |
IMSR (for Hpf1) |
||