Topics

<Return to clone list

ID  21-W312
Registered  2009.08.08    Last Update  2018.10.26
Gene Name histone PARylation factor 1 Gene Symbol Hpf1
Chromosome 8 Genomic Location chr8:63,369,000-63,387,000
Synonyms C230006B22Rik, 2700029M09Rik, C4orf27
Links UCSC Browser(chr8:63,369,000-63,387,000)
NCBI Entrez Gene(72612)
IGTC(Hpf1, 14134)
UniGene(Mm.25263)
MGI(1919862)
KEGG GENES(mmu:72612)
EST Profile(Mm.25263)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB514150 GSS Location chr8:63,369,247-63,369,333 Size 87
Sequence CAGGAGCGCGGGCCTTGGCTCGCTCGCTGCGGCTGCGGGATGGTTGGCGGTGGCGGGAAGCGCCG
GACGGCCGGGGCGGGACCGCAG
Links UCSC Browser(chr8:63,369,247-63,369,333)
IGTC(Ayu21-W312)

Homology Search Results

[NM_028299] Mus musculus RIKEN cDNA 2700029M09 gene (2700029M09Rik), mRNA.

Mouse Information

Card ID 1674 Strain Name B6;CB-2700029M09RikGt(pU-21W)312Card
Internal Code Ayu21-W312
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Hpf1)

<Return to clone list