Topics

<Return to clone list

ID  21-W315
Registered  2009.06.16    Last Update  2011.03.25
Gene Name retinoic acid induced 14 Gene Symbol Rai14
Chromosome 15 Genomic Location chr15:10,495,000-10,648,000
Synonyms Norpeg, mKIAA1334, Ankycorbin, 1700008J19Rik, 1700020L11Rik
Links UCSC Browser(chr15:10,495,000-10,648,000)
NCBI Entrez Gene(75646)
IGTC(Rai14, 5900)
UniGene(Mm.212395)
MGI(1922896)
KEGG GENES(mmu:75646)
EST Profile(Mm.212395)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB508946 GSS Location chr15:10,620,126-10,644,406 Size 211
Sequence GGAGGAGGAGGAGGAGGGACCCAGCGCAGGAAGCCGAGCAGGAAGCGAGCCCGGCAGCCGCACTT
TCCTGGGGAAGCGGCGGGCGGGACGGCCAGCGGGGCCAGGAGCTGAGGCCGCCGCTTGGATGGGG
TATTGACAAATCTCCCAGGACTTTGGAAGGCTGAATGGACTAAACATGAAGAGCCTGAAAGCAAA
GTTTCGGAAGAGCGAT
Links UCSC Browser(chr15:10,620,126-10,644,406)
IGTC(Ayu21-W315)

Homology Search Results

[NM_030690] Mus musculus retinoic acid induced 14 (Rai14), mRNA.

Mouse Information

Card ID 1677 Strain Name B6;CB-Rai14Gt(pU-21W)315Card
Internal Code Ayu21-W315
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Rai14)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list