Topics

<Return to clone list

ID  21-W317
Registered  2009.08.08    Last Update  2018.10.26
Gene Name New Gene Symbol New
Chromosome 8 Genomic Location chr8:126,876,885-126,897,584
Synonyms
Links UCSC Browser(chr8:126,876,885-126,897,584)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB514153 GSS Location chr8:126,887,120-126,887,349 Size 230
Sequence ACGGGGTTTCTCCAGCCCGAAGGAGCGAAGCCGTTACTTTTCTTTTTTCCATGGTGTCTCCTGGA
TGTTCAGTTCTTTGTCCAGCCCAGAGAAGGAGTTCAGTGACCCCCTAGATGACTCCCAGCACCCC
CATCACATTTCCTGGCTTCTCCTGTTCAGTTTGGAGACGCCTACTTAAGGGTGTACATCTGACTA
CAAATCGAAGACTTGTAGAATGCCGTGATAATCTG
Links UCSC Browser(chr8:126,887,120-126,887,349)
IGTC

Homology Search Results

Mouse Information

Card ID 1628 Strain Name B6;CB-Gt(pU-21W)317Card
Internal Code Ayu21-W317
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for New)

<Return to clone list