Topics

<Return to clone list

ID  21-W321
Registered  2010.03.24    Last Update  2017.02.05
Gene Name RIKEN cDNA 1600020E01 gene Gene Symbol 1600020E01Rik
Chromosome 6 Genomic Location chr6:86,474,000-86,515,000
Synonyms
Links UCSC Browser(chr6:86,474,000-86,515,000)
NCBI Entrez Gene(72012)
IGTC
UniGene(Mm.349174)
MGI(1919262)
KEGG GENES
EST Profile(Mm.349174)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB550825 GSS Location chr6:86,475,836-86,477,968 Size 110
Sequence ACTTCCTTTCCGTGCATCAGCAGCCGAATGAGCAAGACAATCCCAGAGAGATGAAGTGAATGACC
CAAGGTTACACAGGATGGAACCTATATCTTCTGATTTCTCTACTG
Links UCSC Browser(chr6:86,475,836-86,477,968)
IGTC(Ayu21-W321)

Homology Search Results

[BC029726] Mus musculus cDNA clone IMAGE:5027084.

Mouse Information

Card ID 1831 Strain Name B6;CB-1600020E01RikGt(pU-21W)321Card
Internal Code Ayu21-W321
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
Links IMSR (for 1600020E01Rik)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list