Topics

<Return to clone list

ID  21-W326
Registered  2010.01.27    Last Update  2018.10.26
Gene Name Mouse early transposon ETn Gene Symbol ETn
Chromosome Unlocalized Genomic Location
Synonyms
Links UCSC Browser
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone trapped this gene
21-50, 21-TJH, 21-B142, 21-51, 21-T37, 21-B162, 21-T338, 21-W95, 21-W62, 21-MT64, 21-W331, 21-W571, 21-T246, 21-MT134
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB543597 GSS Location Size 236
Sequence GAGCCTTGATCAGAGTAACTGTCTTGGCTACGTTTCTTCTTTTGCCCCGTCTAGATTCCTCTTCT
TACAGTCGAGCGGCTTCTCAGTCAAACCGTTCACGTTGCGAGCTGCTGGCGGCCGCAACATTTTG
GCGCCGGAACTGGGACCTGAAGAATGGCAGAGAGATGCTAAGAGGAACGCTGCATTGGAGCTCCA
CAGGAAAGGATCTTCGTATCGGACATCGGAGCAACGGACAG
Links UCSC Browser
IGTC

Homology Search Results

[MMY17106] Mus musculus transposon ETn, SELH/L3A strain.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for ETn)

<Return to clone list