Topics

<Return to clone list

ID  21-W330
Registered  2009.08.08    Last Update  2018.10.26
Gene Name MAP/microtubule affinity-regulating kinase 3 Gene Symbol Mark3
Chromosome 12 Genomic Location chr12:112,810,000-112,895,500
Synonyms ETK1, Emk2, ETK-1, MPK10, KIAA4230, 1600015G02Rik, A430080F22Rik
Links UCSC Browser(chr12:112,810,000-112,895,500)
NCBI Entrez Gene(17169)
IGTC(Mark3, 2585)
UniGene(Mm.420865)
MGI(1341865)
KEGG GENES(mmu:17169)
EST Profile(Mm.420865)
Other clone traped this gene
21-T297
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB514158 GSS Location chr12:112,813,146-112,842,775 Size 413
Sequence TAGACTCCGGCCAGGGAGGGCAGGGCCCGGAGGCTCGCGGCCGCTGCTCGCCGGCCGCCCAAAGC
TGGGCGGTTTTGTTTTCGCCTTGGCGTTGTGCGGAATCAAAGCGCAATAAGATGTCCACTAGGAC
CCCTTTGCCAACGGTGAATGAACGAGACACTGAAAACCACATTTCACATGGAGACGGGAGGCAAG
AAGTCACCTCCCGCACCGGGCGCTCTGGAGCTCGGTGTAGAAACTCAATAGCTTCCTGTGCAGAT
GAACAGCCTCACATCGGAAACTACAGACTGTTGAAAACAATCGGCAAGGGGAACTTTGCAAAAGT
GAAATTGGCGAGACACATCCTCACAGGCCGAGAGGTTGCAATAAAAATAATTGACAAAACTCAGT
TGAATCCAACAAGTCTACAAAAG
Links UCSC Browser(chr12:112,813,146-112,842,775)
IGTC(Ayu21-W330)

Homology Search Results

[NM_021516] Mus musculus MAP/microtubule affinity-regulating kinase 3 (Mark3), transcript variant 1, mRNA.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Mark3)

<Return to clone list