Topics

<Return to clone list

ID  21-W339
Registered  2010.03.24    Last Update  2015.10.22
Gene Name functional intergenic repeating RNA element Gene Symbol Firre
Chromosome X Genomic Location chrX:47,908,000-47,990,000
Synonyms AW048145, 5830467J12Rik, 6720401G13Rik
Links UCSC Browser(chrX:47,908,000-47,990,000)
NCBI Entrez Gene(103012)
IGTC(Firre, 50603)
UniGene(Mm.482523)
MGI(2147989)
KEGG GENES
EST Profile(Mm.482523)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB550827 GSS Location chrX:47,961,655-47,961,992 Size 256
Sequence GAACTGGACGATGAATTTTAACCTCCACACCACAAGCACTGGGGTAGAAGACTGCTGCTGGGTGA
AGAAGAGACTAGACTTGATCATTGAGCAGCCACTCACTGATATCTTCAGTGCTGCATGAGGAAGA
GTTTATTCTTCTGGATTTGGTGGTGGATTCTGGTGAAGATACAGATGGATGCTCTGGCTGAGTCG
CTACCTTGAAATGAAAATGGGAGGTAAACTCTCCCATAGATGAATCTTCCTCATTTTGAAG
Links UCSC Browser(chrX:47,961,655-47,961,992)
IGTC(Ayu21-W339)

Homology Search Results

[NR_015505] Mus musculus RIKEN cDNA 6720401G13 gene (6720401G13Rik), transcript variant 1, non-coding RNA.

Mouse Information

Card ID 1809 Strain Name B6;CB-6720401G13RikGt(pU-21W)339Card
Internal Code Ayu21-W339
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Firre)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list