Topics

<Return to clone list

ID  21-W34
Registered  2008.04.24    Last Update  2012.03.24
Gene Name cell adhesion molecule 1 Gene Symbol Cadm1
Chromosome 9 Genomic Location chr9:47,335,000-47,670,000
Synonyms Igsf4a, SgIGSF, Necl2, Igsf4, Tslc1, RA175N, RA175B, RA175C, RA175A, SynCam
Links UCSC Browser(chr9:47,335,000-47,670,000)
NCBI Entrez Gene(54725)
IGTC(Cadm1, 2862)
UniGene(Mm.234832)
MGI(1889272)
KEGG GENES(mmu:54725)
EST Profile(Mm.234832)
Other clone traped this gene
21-T401
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB435089 GSS Location chr9:47,338,439-47,338,588 Size 155
Sequence CAGTATGAGGCAGGTGCCCGCACATGGCGAGTNCTGTGCTGCCGAGCGGATCCCAGTGTNCGGCG
GCAGCGGCTGTGGCGGCGGCGGCGGCGCCTCCAGGGCTCCGGCTCCGGCTCCTGCTGTTGCTCCT
TTCGGCCGCGGCACTATCCCCACAG
Links UCSC Browser(chr9:47,338,439-47,338,588)
IGTC(Ayu21-W34)

Homology Search Results

[AF434663] Mus musculus tumor suprressor in lung cancer 1 mRNA, complete cds.

Mouse Information

Card ID 1165 Strain Name B6;CB-Cadm1Gt(pU-21W)34Imeg
Internal Code Ayu21-W34
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "IGSF4 is a novel TCR zeta-chain-interacting protein that enhances TCR-mediated signaling." Hye-Ran Kim, Byeong-Hun Jeon, Hyun-Su Lee, Sin-Hyeog Im, Masatake Araki, Kimi Araki, Ken-ichi Yamamura, Suck-Chei Choi, Do-Sim Park, and Chang-Duk Jun, J. Exp. Med., 208, 2545-2560 (2011).. PubMed ID:22084409.
Links IMSR (for Cadm1)

<Return to clone list