Topics

<Return to clone list

ID  21-W341
Registered  2009.08.08    Last Update  2010.11.26
Gene Name tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene Symbol Tanc1
Chromosome 2 Genomic Location chr2:59,449,000-59,690,000
Synonyms Tanc, mKIAA1728, 1200003E16Rik
Links UCSC Browser(chr2:59,449,000-59,690,000)
NCBI Entrez Gene(66860)
IGTC(Tanc1, 2553)
UniGene(Mm.27917)
MGI(1914110)
KEGG GENES(mmu:66860)
EST Profile(Mm.27917)
Other clone trapped this gene
21-W44, 21-W579
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB514162 GSS Location chr2:59,450,099-59,450,253 Size 155
Sequence GGGGACGGGCCGGAGCGCTGCCTCCGCGGTGGCAGCTGCGGGAGCCCGGCTCGGGAGCCGCAGGA
GCCGCAGCCGCCAAGCGCCCAGCCCTCTGCGCCCTGAGGCTCGGCCCCCGGGGTGGGAACCGCGC
CGAAAGCTGGAAACTTTCCTGGCAG
Links UCSC Browser(chr2:59,450,099-59,450,253)
IGTC(Ayu21-W341)

Homology Search Results

[NM_198294] Mus musculus tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 (Tanc1), mRNA.

Mouse Information

Card ID 1685 Strain Name B6;CB-Tanc1Gt(pU-21W)341Card
Internal Code Ayu21-W341
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Tanc1)

<Return to clone list