| Topics |
ID 21-W343
| Gene Name | insulin-like growth factor 2 mRNA binding protein 2 | Gene Symbol | Igf2bp2 | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 16 | Genomic Location | chr16:22,058,000-22,154,000 | ||||
| Synonyms | IMP-2, Imp2, Neilsen, C330012H03Rik | ||||||
| Links | UCSC Browser(chr16:22,058,000-22,154,000) NCBI Entrez Gene(319765) IGTC(Igf2bp2, 15542) UniGene(Mm.294740) |
MGI(1890358) KEGG GENES(mmu:319765) EST Profile(Mm.294740) |
|||||
| Other clone trapped this gene |
|---|
| Trap vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB517703 | GSS Location | chr16:22,161,319-22,162,983 | Size | 186 |
| Sequence | CCTCCGGCAGCTCTTCGGGGACAGGAAGCTGCCCCTGGCGGGACAGGTCCTACTCAAGTCCGGCT ACGCCTTCGTGGACTACCCCGACCAGAACTGGGCCATCCGCGCCATCGAGACCCTCTCGGGTAAA GTGGAATTGCATGGGAAAATCATGGAAGTTGACTACTCAGTCTCTAAAAAGCTAAG |
||||
| Links | UCSC Browser(chr16:22,161,319-22,162,983) IGTC(Ayu21-W343) |
||||
Homology Search Results
| [NM_183029] Mus musculus insulin-like growth factor 2 mRNA binding protein 2 (Igf2bp2), mRNA. |
Mouse Information
| Card ID | Strain Name | ||
|---|---|---|---|
| Internal Code | |||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||
| Links |
IMSR (for Igf2bp2) |
||