Topics

<Return to clone list

ID  21-W343
Registered  2009.08.29    Last Update  2018.10.26
Gene Name insulin-like growth factor 2 mRNA binding protein 2 Gene Symbol Igf2bp2
Chromosome 16 Genomic Location chr16:22,058,000-22,154,000
Synonyms IMP-2, Imp2, Neilsen, C330012H03Rik
Links UCSC Browser(chr16:22,058,000-22,154,000)
NCBI Entrez Gene(319765)
IGTC(Igf2bp2, 15542)
UniGene(Mm.294740)
MGI(1890358)
KEGG GENES(mmu:319765)
EST Profile(Mm.294740)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB517703 GSS Location chr16:22,161,319-22,162,983 Size 186
Sequence CCTCCGGCAGCTCTTCGGGGACAGGAAGCTGCCCCTGGCGGGACAGGTCCTACTCAAGTCCGGCT
ACGCCTTCGTGGACTACCCCGACCAGAACTGGGCCATCCGCGCCATCGAGACCCTCTCGGGTAAA
GTGGAATTGCATGGGAAAATCATGGAAGTTGACTACTCAGTCTCTAAAAAGCTAAG
Links UCSC Browser(chr16:22,161,319-22,162,983)
IGTC(Ayu21-W343)

Homology Search Results

[NM_183029] Mus musculus insulin-like growth factor 2 mRNA binding protein 2 (Igf2bp2), mRNA.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Igf2bp2)

<Return to clone list