| Topics |
ID 21-W347
| Gene Name | erythroid differentiation regulator 1 | Gene Symbol | Erdr1 | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | Y | Genomic Location | |||||
| Synonyms | edr, MGC5764 | ||||||
| Links | UCSC Browser NCBI Entrez Gene(170942) IGTC UniGene(Mm.391385) |
MGI(2384747) KEGG GENES(mmu:170942) EST Profile(Mm.391385) |
|||||
| Other clone trapped this gene |
|---|
| 21-KBT47, 21-T47, 21-KBW221, 21-KBW177, 21-W14, 21-KBW106, 21-KBW112, 21-KBW113, 21-KBW116, 21-KBW178, 21-KBW183, 21-KBW154, 21-W442, 21-KBW209, 21-W521, 21-KBW241, 21-KBW252, 21-B173, 21-7, 21-62 |
| Trap vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB517705 | GSS Location | Size | 149 | |
| Sequence | CCCGCTGCAGAACCGTGACCGTCCGCCGGTCACGGCCGCCGCCCCCAGCGACGTCACCCACACGC GCAGAAGCGGACGCCGCGGTCAAGATGTCTCTGCCATGCCCACGGGACGCACGGACGCACGGACG GACGGACTGACTCCACAAG |
||||
| Links | UCSC Browser IGTC(Ayu21-W347) |
||||
Homology Search Results
| [CR536618] Mouse DNA sequence from clone RP24-143B12 on chromosome X, complete sequence. |
Mouse Information
| Card ID | 2746 | Strain Name | B6;CB-Erdr1Gt(pU-21W)347Card |
|---|---|---|---|
| Internal Code | Ayu21-W347 | ||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
| Links |
IMSR (for Erdr1) |
||