Topics

<Return to clone list

ID  21-W348
Registered  2009.10.14    Last Update  2018.10.26
Gene Name New Gene Symbol New
Chromosome 9 Genomic Location chr9:64,735,000-64,769,000
Synonyms
Links UCSC Browser(chr9:64,735,000-64,769,000)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB525692 GSS Location chr9:64,766,326-64,766,483 Size 158
Sequence ACAGCACCAGTGTTTTCAAGTAAGTTAGTTCAGCCTCAGCCAACTGAACTCAAGATTCACATTTT
ATGCTCTCCACAACTTGCCAGAGGCAAAAGCTCTGCAGCCTGGCTACTCAATGGGGGCAGGGACC
GAAAGGCAGCTCTCCTGCGGCTGAACGG
Links UCSC Browser(chr9:64,766,326-64,766,483)
IGTC

Homology Search Results

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. This clone may trap the anti-sense RNA of Dennd4a gene.
Links IMSR (for New)

<Return to clone list