Topics

<Return to clone list

ID  21-W349
Registered  2009.10.14    Last Update  2018.10.26
Gene Name LTR Gene Symbol LTR
Chromosome Unlocalized Genomic Location
Synonyms
Links UCSC Browser
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
21-T263, 21-KBW138, 21-T32, 21-T165, 21-T83, 21-MT92, 21-MT109, 21-MT117, 21-MT120, 21-MT132
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB525693 GSS Location Size 121
Sequence GTTAGTCTTCCACTAGCAGCCTTTGGATGAAGACATAGAACTCTCAGCTCCTCCTGCGCCATGCC
TGCCTGGATACTGCCATGCTCCCACCTTGATGATAATGGACTGAACCTCTGAACCT
Links UCSC Browser
IGTC

Homology Search Results

[CN715412] E0707B07-5 NIA Mouse four-cell-Embryo cDNA library (Long) Mus musculus cDNA clone NIA:E0707B07 IMAGE:30896658 5', mRNA sequence.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for LTR)

<Return to clone list