Topics

<Return to clone list

ID  21-W36
Registered  2008.04.18    Last Update  2018.10.26
Gene Name New Gene Symbol New
Chromosome 15 Genomic Location chr15:81,779,665-81,819,174
Synonyms
Links UCSC Browser(chr15:81,779,665-81,819,174)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB434698 GSS Location chr15:81,799,201-81,799,639 Size 439
Sequence TGTGTGTGNGGGGTGTGTGTTCTGCTCTGCTCTAGACAGCGTTTTCTTGCTATTCTAAAAACTGG
TTGAGACTGCTCTCTCTGCTACTAAAAATCATAAAAACTATCTGAAAAGCTCATGGATTTTCTGA
CCAAAGTCAGAAAAGCTGCTATAAAAACTCTTGGATCTTCCAACCAAGTCAGAAGCCATGTTAGA
AAAAGATCCTTGAAGAGCTGTTTTTGTTCTCCAGAGATCTCCAAACAGCTCAGCTCTCACTAGAG
AAAAATTCTAAAGAACGGCTATCATGGTCTGCTAGCTCATCTCCTACAGACCTAAAGGGTTGCAG
CCAGCCAGCGGCTCACACGTCTGGGTTCTAGTCTGGAAAGGCATCTTGGAATCTGGAAGAGAAGA
CGGGGCTAGGCGGCACGATAGAGAGGAACCAAGACAAGGTCTGATCAAG
Links UCSC Browser(chr15:81,799,201-81,799,639)
IGTC

Homology Search Results

Mouse Information

Card ID 1195 Strain Name B6,Cg-Gt(pU-21W)36Card
Internal Code Ayu21-W36
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for New)

<Return to clone list