Topics

<Return to clone list

ID  21-W360
Registered  2009.12.05    Last Update  2018.10.26
Gene Name EST Gene Symbol EST
Chromosome 9 Genomic Location chr9:113,650,383-113,650,765
Synonyms
Links UCSC Browser(chr9:113,650,383-113,650,765)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB535733 GSS Location chr9:113,650,447-113,650,701 Size 242
Sequence CGACACGCAGAGACGCCGCTGCNTGGGTCGGCGGCGGCGGGGGACGGCCCCCCTAAACTAATCAA
ACTCGGCGCCCCCCGGTCCCAGCCCCGCTTCAGAGGCTGCGGCTGCCGGCGACGTCAGCGCGCGC
GTGACGTCAGAGCGACGCGCCCGGCTCCAGCCCGGCCTCCCGGCGCGCCCGAGCCCCTGTGGGCT
GCGGCCTGTGGCGCTACTGATGGCCCGAGCTTGGGCTCGTGTGGGTC
Links UCSC Browser(chr9:113,650,447-113,650,701)
IGTC

Homology Search Results

[BG806514] 2031-94 Mouse E14.5 retina lambda ZAP II Library Mus musculus cDNA, mRNA sequence.

Mouse Information

Card ID 1801 Strain Name B6;CB-Gt(pU-21W)360Card
Internal Code Ayu21-W360
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for EST)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list