Topics

<Return to clone list

ID  21-W363
Registered  2009.10.17    Last Update  2011.05.03
Gene Name ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 Gene Symbol Agap1
Chromosome 1 Genomic Location chr1:91,350,000-91,800,000
Synonyms Ggap1, Centg2, R75364, mKIAA1099
Links UCSC Browser(chr1:91,350,000-91,800,000)
NCBI Entrez Gene(347722)
IGTC(Agap1, 8138)
UniGene(Mm.291135)
MGI(2653690)
KEGG GENES(mmu:347722)
EST Profile(Mm.291135)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB525779 GSS Location chr1:91,351,884-91,352,167 Size 284
Sequence GCCTCCTCGGCTCCGTGCTCCCCGGGGGCTGCGGCGCCCCGGGTCTCGGTGGCCCGCGGGGCTCC
GGGGCGCGGGGCGGCGACGACGGGGGGCGCGCGGCTTTGGGCGCCGCGCCTGCACCATGAACTAC
CAGCAGCAGCTGGCCAACTCGGCTGCCATCCGGGCCGAGATCCAGCGCTTCGAGTCGGTCCACCC
CAACATCTACTCCATCTACGAGCTGCTGGAGCGCGTGGAGGAGCCGGTGCTGCAGAACCAGATTC
GGGAGCACGTCATCGCCATCGAAG
Links UCSC Browser(chr1:91,351,884-91,352,167)
IGTC(Ayu21-W363)

Homology Search Results

[NM_178119] Mus musculus ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 (Agap1), transcript variant 1, mRNA.

Mouse Information

Card ID 1751 Strain Name B6;CB-Agap1Gt(pU-21W)363Card
Internal Code Ayu21-W363
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Agap1)

<Return to clone list